Abstract
Periosteum is important for bone homoeostasis through the release of bone morphogenetic proteins (BMPs) and their effect on osteoprogenitor cells. Smoking has an adverse effect on fracture healing and bone regeneration. The aim of this study was to evaluate the effect of smoking on the expression of the BMPs of human periosteum. Real-time polymerase chain reaction was performed for BMP-2,-4,-6,-7 gene expression in periosteal samples obtained from 45 fractured bones (19 smokers, 26 non-smokers) and 60 non-fractured bones (21 smokers, 39 non-smokers). A hierarchical model of BMP gene expression (BMP-2 > BMP-6 > BMP-4 > BMP-7) was demonstrated in all samples. When smokers and non-smokers were compared, a remarkable reduction in the gene expression of BMP-2, -4 and -6 was noticed in smokers. The comparison of fracture and non-fracture groups demonstrated a higher gene expression of BMP-2, -4 and -7 in the non-fracture samples. Within the subgroups (fracture and non-fracture), BMP gene expression in smokers was either lower but without statistical significance in the majority of BMPs, or similar to that in non-smokers with regard to BMP-4 in fracture and BMP-7 in non-fracture samples. In smokers, BMP gene expression of human periosteum was reduced, demonstrating the effect of smoking at the molecular level by reduction of mRNA transcription of periosteal BMPs. Among the BMPs studied, BMP-2 gene expression was significantly higher, highlighting its role in bone homoeostasis.
Periosteum is a specialised connective tissue that forms a thin tough fibrous membrane firmly attached to bone, with pluripotential mesenchymal cells in its undersurface (cambium layer).1-4 These cells, combined with growth factors regularly produced by or released from the surrounding tissues, play an important role in bone and cartilage homoeostasis.1-5 During the process of fracture healing several growth factors – members of the transforming growth factor-β (TGF-β) superfamily – are released from the periosteum and stimulate precursor mesenchymal cells or osteoprogenitors.1,2,6,7 The major osteoblast-stimulating factors within the TGF-β family are the bone morphogenetic proteins (BMPs), which play an important role in the maintenance of bone mass.7-10 They induce the differentiation of bone marrow stromal cells towards the osteoblastic lineage, thereby increasing the pool of mature bone-forming cells and enhancing the function of osteoblasts.11-13 The constant osteogenetic procedure required for bone growth, remodelling and repair in vertebrates is regulated by the availability of a subset of BMPs, which include BMP-2, -4, -6, -7 and -9.10-13
Cigarette smoking has been shown to be a risk factor for a variety of diseases and conditions, including cancer and coronary heart disease.14,15 In relation to fracture healing, the adverse effect of smoking is related to the vasoconstriction induced by smoking.16 Orthopaedic surgeons have long hypothesised that there is a link between smoking and complications of fracture healing. The impaired healing and the delayed fracture union due to smoking have been documented in patients,16-20 and laboratory studies have shown that smoke inhalation delays bone healing in animal models.21 However, at the molecular level the underlying mechanism(s) and causative factor(s) remain unknown, in spite of clinical investigations including animal studies and in vitro tests on bone-forming cells.
The aim of this study was to evaluate the effect of smoking on the expression of periosteal BMPs in samples of human periosteum obtained from fractured and non-fractured bones, during osteosynthesis and reconstructive orthopaedic procedures.
Materials and Methods
After approval from the institutional review board, periosteal samples were obtained prospectively from a total of 45 consecutive patients with peripheral fractures operated on at a university hospital within 24 hours of fracture. There were 30 men and 15 women with a mean age of 49 years (21 to 87). The most common site of fracture was the femur in ten cases (22%) followed by the fibula in eight (18%) (Table I). Non-fractured (normal) samples were also obtained during the same period from 60 patients undergoing reconstructive procedures, such as total knee and hip replacement and osteotomies. There were 32 men and 28 women with a mean age of 52 years (19 to 82). The most common site from which the sample was taken was the femur in 16 cases (27%) (Table I).
Table I
Demographics and characteristics of the patients from which the periosteum samples were taken
| Fracture | Non-fracture | |
|---|---|---|
| Number of patients | 45 | 60 |
| Male:female | 30:15 | 32:28 |
| Mean age (yrs) (range) | 49 (21 to 87) | 52 (19 to 82) |
| Smokers (n, %) | 19 (42) | 21 (35) |
| Male:female | 19:0 | 14:7 |
| Mean age (yrs) (range) | 42 (21 to 75) | 45 (19 to 82) |
| Non-smokers (n, %) | 26 (58) | 39 (65) |
| Male:female | 11:15 | 18:21 |
| Mean age (yrs) (range) | 56 (21 to 87) | 58 (23 to 79) |
| Origin of sample (n, %) | ||
| Femur | 10 (22) | 16 (27) |
| Fibula | 8 (18) | 4 (7) |
| Tibia | 5 (11) | 3 (5) |
| Metatarsal | 2 (4) | 9 (15) |
| Humerus | 1 (2) | 2 (3) |
| Radius | 6 (13) | 9 (15) |
| Ulna | 4 (9) | 4 (7) |
| Phalanx | 6 (13) | 7 (12) |
| Metacarpal | 3 (6) | 6 (10) |
A total of 19 patients (42%) in the fracture group were current smokers, compared with a total of 21 patients (35%) in the non-fracture group. The gender and age distribution of the smoking or non-smoking subgroups is shown in Table I. Those who smoked in both groups had done so for a mean of 20 years (7 to 40) in the fracture group and 20 years (8 to 35) in the non-fracture group, and all smoked at least one pack (20 cigarettes) per day. Patients who had previously smoked and later stopped were excluded from the study.
Periosteum collection
Periosteal samples were placed in normal saline and immediately homogenised with TRIzol reagent (Invitrogen, Carlsbad, California), a monophasic solution of phenol and guanidine isothiocyanate designed to isolate RNA from cell and tissue samples.
RNA extraction and cDNA preparation
Total cellular RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA quality was determined by electrophoresis and absorbance spectrophotometry. RNA was transcribed in vitro to cDNA using Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT) (Roche Diagnostics, Mannheim, Germany) and random hexamers as primers; as a control for the presence of amplifiable cDNA, retinoic acid receptor α sequences (RARa) were amplified in separate reactions. In both the RT and the ensuing amplification reactions, precautions were taken to prevent cross-contamination of the samples. In addition, for each experiment a control with no template was used to check for the presence of any contaminant.
Quantitative real-time polymerase chain reaction (Q-RT-PCR) assessment of BMP-2, BMP-4, BMP-6 and BMP-7 mRNA expression
In order to quantify BMP-2, BMP-4, BMP-6 and BMP-7 mRNA transcripts, we developed and evaluated real-time fluorescence PCR assays for the Roche LightCycler (LC; Roche Diagnostics, Mannheim Germany). After adding 18 µl water to the reverse transcription reaction product, 2 µl aliquots were used for each reaction. In a separate PCR reaction, the same cDNA was evaluated for expression of the human porphobilinogen deaminase (h-PBGD) gene (LightCycler h-PBGD Housekeeping Gene Set h-PBGD kit; Roche Diagnostics) as a control. The amplification mixture consisted of 2 µl of 10× reaction mix (LC-FastStart master hybridisation probes; Roche Diagnostics), 3 mM/3 mM/1 mM/1 mM MgCl2 for BMP-2, BMP-4, BMP-6 and BMP-7, respectively), a 0.5 µM concentration of each oligonucleotide primer, a 0.15 µM concentration of each oligonucleotide probe and 2 µl of template cDNA in a final volume of 20 µl. Samples were amplified as follows: an initial denaturation step at 95°C for 10 min to activate the FastStart Taq DNA polymerase, 45 cycles of denaturation at 95°C for 5 s, annealing at 53°C/57°C/50°C/55°C for 10 s for BMP-2, BMP-4, BMP-6 and BMP-7, respectively, and extension at 72°C for 10/8/5/10 s for BMP-2, BMP-4, BMP-6 and BMP-7, respectively. The temperature transition rate was 20°C/s. The quantification for each gene analyses the amount of a target transcript relative to an internal standard (a housekeeping gene, h-PBGD) in the same sample. The copy number of target cDNA molecules for each of the cycle threshold (Ct) values was determined from standard curves for each BMP and h-PBGD gene. Ct is defined as the number of cycles required for the fluorescent signal to cross the threshold. Results were presented as absolute number of target cDNA molecules for each BMP divided by the number of target cDNA molecules for h-PBGD. All experiments were performed in triplicate and the mean values used.
DNA oligonucleotide primers and hybridisation probes were synthesised by TIB Molbiol (TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany). The adjacent ends of the hybridisation probes were labelled with fluorophores. The 5′ end of the first probe was labelled with the acceptor fluorophore LC Red 640 and the 3′ end of the second probe with the donor fluorescein (FITC, 3FL). The 5′-labelled probes were 3′-phosphorylated to block polymerase extension during PCR. Nucleotide sequences of the primers and hybridisation probes are shown in Table II.
Table II
Sequences of the primers used for the real-time polymerase chain reaction (RT-PCR) amplification of the bone morphogenetic protein BMP-2,BMP-4, BMP-6 and BMP-7 genes
| Primers | Sequences | PCR product size (base pair, bp) |
|---|---|---|
| BMP2 forward | 5’- AGTTTTCCTCGTGCGTACT | 257 |
| BMP2 reverse | 5’- AAACCCGTCTGTAGCTTCTTA | |
| BMP4 sense | 5’- CTTGTTTTCTGTCAAGACACCATGATT | 207 |
| BMP4 reverse | 5’- GCAGAAGTGTCGCCTCGAAG | |
| BMP6 sense | 5’- CTCTACCCAGTCCCAGGA | 114 |
| BMP6 reverse | 5’- TCCCAGGTCTTGGAAACT | |
| BMP7 forward | 5’- CAGAGCATCAACCCCAAGTT | 250 |
| BMP7 antisense | 5’- CTGACATACAGCTCGTGCTTCTTA | |
| Probes | ||
| BMP2 FL | 5’- TGGGCTATTTGGACTGTGCTGTT--FL | |
| BMP2 LC | 5’- LC640-TTCAATTAGTGATAATGTATGGGAAGTCCT--PH | |
| BMP4 FL | 5’- CCCGTCTCAGGTATCAAACTAGCATGGCTC--FL | |
| BMP4 LC | 5’- LC640- CGCCTCCTAGCAGGACTTGGCA--PH | |
| BMP6 FL | 5’- AGGCTGTTTTCAATTCACTGCTGT--FL | |
| BMP6 LC | 5’- LC640- GTAATCTGAAGCACTGGAGACCCGC--PH | |
| BMP7 FL | 5’- ACCAGGAAGCCCTGCGGATG--FL | |
| BMP7 LC | 5’- LC640- CCAACGTGGCAGAGAACAGCAGCA--PH |
Statistical analysis
A log transformation was applied to all outcome variables (BMP-2, BMP-4, BMP-6, BMP-7) as well as a general linear model after checking for non-violation of assumptions. The Bonferroni criterion was used to assess statistically significant differences in values of the outcome variables by condition, smoking, and their interaction. Statistical significance was set at p < 0.05. The analysis was carried out with the use of STATISTICA v8.0 (StatSoft, Tulsa, Oklahoma).
Results
A hierarchical model of BMP gene expression (BMP-2 > BMP-6 > BMP-4 > BMP-7) was demonstrated in all samples and subgroups.
The mRNA levels of BMP in smokers were lower than those of non-smokers in all samples, and the difference was statistically significant for BMP-2, BMP-4 and BMP-6 (Table III).
Table III
Mean values of cDNA copy number of bone morphogenetic protein (BMP)-2, BMP-4, BMP-6 and BMP-7 gene ratios (relative to copy numbers of h-PBGD) and statistical significance of comparison between smokers and non-smokers in all samples as estimated with the use of the Bonferroni criterion after applying a general linear model
| Smokers (n = 40) | Non-smokers (n = 65) | p-value | |
|---|---|---|---|
| BMP-2 | 5051 | 10 581 | 0.0009 |
| BMP-4 | 0894 | 1389 | 0.0357 |
| BMP-6 | 1734 | 3118 | 0.0018 |
| BMP-7 | 0033 | 0039 | 0.1692 |
A statistically significantly higher expression in the mean mRNA levels of BMP-2 (p = 0.0002), BMP-4 (p = 0.0001) and BMP-7 (p = 0.0256) was observed in the non-fracture samples, whereas BMP-6 had similar expression in both groups (p = 0.6938) (Fig. 1).
Fig. 1
Box plots showing the mean values of cDNA copy number of BMP-2, -4, -6 and -7 gene ratios (relative to copy numbers of human Porphobilinogen Deaminase (h-PBGD) in non-fracture and fracture samples. The boxes represent the median values and the interquartile range, with the dotted line denoting the mean, the whiskers representing the 90th and 10th percentiles and the outlying points extreme values.
The effect of smoking on mRNA level for each BMP in the different subgroups is shown in Table IV. The majority of mRNA BMP levels were lower (but not statistically significant) in smokers, whereas BMP-4 and BMP-7 genes were similarly expressed in fracture and non-fracture samples, respectively (Table IV).
Table IV
The effect of smoking on gene expression for each bone morphogenetic protein (BMP) in the different subgroups. Table shows mean values of cDNA copy number of BMP-2, BMP-4, BMP-6 and BMP-7 gene ratios (relative to copy numbers of h-PBGD) and the statistical significance of comparison between smokers and non-smokers in fractured and non-fractured samples, respectively, as estimated with the use of the Bonferroni criterion after applying a general linear model
| Fractured | Non-fractured | ||||||
|---|---|---|---|---|---|---|---|
| Smokers (n = 19) | Non-smokers (n = 26) | p-value | Smokers (n = 21) | Non-smokers (n = 39) | p-value | ||
| BMP-2 | 2163 | 4610 | 0.598 | 7665 | 14 509 | 0.051 | |
| BMP-4 | 0496 | 0481 | 1.000 | 1253 | 1987 | 0.368 | |
| BMP-6 | 1733 | 3080 | 0.254 | 1734 | 3143 | 0.082 | |
| BMP-7 | 0004 | 0031 | 1.000 | 0059 | 0045 | 1.000 | |
Discussion
Several studies have provided preliminary evidence of a link between smoking and delayed healing,22-25 nonunion,22 infection,26 osteomyelitis27 and fracture risk.28 Clinical observations suggest that the more cigarettes smoked, the longer the time required for union of a long bone fracture.29 In prospective studies, smokers were found to have significantly reduced bone mass compared to non-smokers at all sites.30 Smoking has a negative influence on bone mass independent of weight and physical activity,31 and stopping smoking seems to have a positive influence on bone mass.30,32 Although the effects of smoking are partially attributed to vasoconstriction, the molecular basis, and especially the effect on growth factors responsible for the osteogenic lineage, such as the BMPs, has not yet been identified.
BMPs share action on bone homoeostasis with a number of other molecules that are members of the TGF-β superfamily, but their effects seem to be superior and more specific.6 Research workers have tried to classify the osteogenic activity of BMPs in mesenchymal progenitors and osteoblastic cells by measuring the induction of alkaline phosphatase, osteocalcin and matrix mineralisation. They have shown that BMPs -2, -4, -6, -7 and -9 are responsible for the increase of either alkaline phosphatase or osteocalcin in pluripotent or pre-osteoblastic cells.7 Cheng et al,7 in cell cultures with rhBMPs, reported an osteogenic hierarchical model where BMP-2 and BMP-6 may be two of the most potent agents to induce osteoblast lineage-specific differentiation of mesenchymal progenitor cells, and most BMPs can effectively promote the terminal differentiation of committed osteoblastic precursors and osteoblasts.
In our study, we analysed mRNA levels of BMP-2, BMP-4, BMP-6 and BMP-7 genes in human periosteal cells and compared smokers to non-smokers in order to estimate the effect of smoking on the gene expression of BMPs in human periosteum. Our results indicate high BMP-2 mRNA levels expressed from periosteal cells compared with other BMPs, in both normal and fracture samples, and in samples obtained from smokers and non-smokers, showing the precocious role of BMP-2 in osteogenic lineage. BMP-6 mRNA levels were also relatively high, albeit lower than BMP-2 levels. However, the suppression of BMP-2, BMP-4 and BMP-7 observed in the fracture group compared with the non-fracture group was not observed in BMP-6 gene expression. The similar mRNA levels of BMP-6 in the two groups indicate the potential role of BMP-6 in the early stages of mesenchymal stem cell differentiation in human periosteum. It has recently been shown that BMP-6 displays significantly more pronounced BMP reporter activation, osteoblast differentiation and stimulation of fracture healing than the most closely related family member, which according to their genetic code is BMP-7.33 Furthermore, BMP-4 gene expression remained low in all subgroups. BMP-4 mRNA levels are known to be BMP dependent.34 The transient increase in BMP-4 gene expression might be necessary for differentiation of the cells into functional osteoblasts, whereas its downregulation facilitates a local control mechanism.34 Therefore, as shown in our study, lower gene expression in BMP-4 was predictable, as mRNA levels of BMP-2 were too high. Moreover, in contrast to the known role of BMP-7 in bone regeneration and homoeostasis, the very low BMP-7 mRNA levels detected in our study indicate that in the early phases of osteogenic lineage BMP-7 gene expression is downregulated.7,35
Clinicians have suspected that smoking interferes with bone physiology, as it deprives bone of the blood supply that is vital for its homoeostasis. Most studies concerning the effects of tobacco usage on bone mass and fracture healing provide evidence of an adverse effect.28,36-41 Furthermore, researchers who consider nicotine to be the most important constituent of tobacco products (among > 4000 potentially toxic substances) have conducted several studies trying to estimate the impact of nicotine on bone healing and regeneration at the molecular level. In animal models, it has been shown that nicotine inhibits the expression of genes related to osteogenic activity (BMPs, TGF-β, alkaline phosphatase (ALP), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG)), especially in high doses.42-45
In our study we emphasised the effect of smoking on the expression of genes with osteogenic activity in human periosteal samples. Therefore, all our samples were categorised into smokers and non-smokers, independent of whether they had sustained a fracture or not. We observed that BMPs mRNA levels in smokers were lower than in non-smokers, and the difference was statistically significant for BMP-2, BMP-4 and BMP-6 genes. This finding supports the fact that smoking leads to downregulation of BMPs in human periosteum. Thereafter, we compared the findings from fracture and non-fracture samples. The majority of BMP gene expression was reduced almost twofold in all our samples from smokers compared to those from non-smokers, except for BMP-4 and BMP-7 gene expression in fracture and non-fracture samples, respectively, which remained similar in both smokers and non-smokers. It is important to emphasise that this reduction was observed mainly in the gene expression of the two most osteo-inductive BMPs, BMP-2 and BMP-6, in both fracture and non-fracture samples. In particular, BMP-2 mRNA levels were reduced almost to half in the smokers’ group, in both fracture and non-fracture samples, but the decrease did not reach statistical significance in non-fracture samples. The mRNA levels of BMP-6 were reduced by slightly less than half in both fracture and non-fracture samples. In all groups, the decrease in gene expression, especially of BMP-2 and BMP-6 in periosteal cells of smokers (when compared with non-smokers), indicates the correlation of smoking with the reduction in mRNA transcripts of periosteal BMPs. These findings are noteworthy, considering the critical role of BMP-2 and BMP-6 genes in the early stages of osteogenic lineage.7
BMPs, whose critical role in osteogenic lineage is well established, seem to vary in their expression in relation to smoking. Ma et al42,43 highlighted a mechanism whereby nicotine could compromise bone formation and remodelling by affecting the expression of osteogenic and angiogenic growth factors, including BMP-2. Giorgetti et al45 indicated that higher BMP-2 mRNA levels were sustained for a longer period in the control group, whereas smoking resulted in an abrupt decrease at day ten. However, in the same study, BMP-7 gene expression seems to have a similar pattern in both control and test groups, and according to the authors the higher levels of BMP-7 in the smoke-exposed animals could indicate a feedback response compensating for the abrupt decrease in BMP-2 to maintain the new bone formation process, which is reported to be limited rather than blocked. Also, Theiss et al46 showed that nicotine downregulates expression of BMP-2, -4 and -6, and Zheng, Ma and Cheung47 showed that nicotine significantly reduced the intensity of the BMP-2 signal in osteoblastic cells during bone regeneration in rabbits.
Our study has limitations. The sample was relatively small, comprising 45 fracture and 60 non-fracture samples, and the smokers subgroup of the fracture group consisted of male patients only. In addition, the effect of temporal closeness of trauma to the reduction in BMP values cannot be evaluated because all fractures were recent and operated on within five to 24 hours. Thus, further studies concerning the effect of gender, age, interval between fracture and treatment and extent of the smoking habit are necessary.
Knowing that BMPs play a central role in bone growth, remodelling and healing, and that smoking affects bone physiology and homoeostasis, the question arises whether smoking could affect the molecular base of osteogenic lineage. Our work indicates that smoking may affect the osteogenic activity at the primary molecular level through suppression of periosteal BMP gene expression at the transcriptional level.
1 Malizos KN , PapatheodorouLK. The healing potential of the periosteum molecular aspects. Injury2005;36(Suppl):S13–S19. Google Scholar
2 Fedarko NS, Robey PG. Bone cells and their function. In: Canalis E, ed. Skeletal growth factors. Philadelphia: Lippincott Williams & Wilkins, 2000:1–16. Google Scholar
3 Schenk RK. Biology of fracture repair. In: Bruce D, Browner I, eds. Skeletal trauma: basic science, management and reconstruction. Third ed. Philadelphia: Elsevier Saunders, 2003:29–73. Google Scholar
4 Vaccaro A. Orthopaedic knowledge update. In: Muschler GF, Nakamoto C, Grauer JN, eds. Bone healing grafting. Rosemont: American Academy of Orthopaedic Surgeons, 2005:29–37. Google Scholar
5 Gazzerro E , CanalisE. Bone morphogenetic proteins and their antagonists. Rev Endocr Metab Disord2006;7:51–65. Google Scholar
6 Shimizu T , SasanoY, NakajoS, KagayamaM, ShimauchiH. Osteoblastic differentiation of periosteum derived-cells is promoted by the physical contact with the bone matrix in vivo. Anat Rec2001;264:72–81. Google Scholar
7 Cheng H , JiangW, PhillipsFM, et al.Osteogenic activity of the fourteen types of human bone morphogenetic proteins (BMPs). J Bone Joint Surg [Am]2003;85-A:1544–1552. Google Scholar
8 Kwong FN , HarrisMB. Recent developments in the biology of fracture repair. J Am Acad Orthop Surg2008;16:619–625. Google Scholar
9 De Biase P , CapannaR. Clinical applications of BMPs. Injury2005;36(Suppl):43–46. Google Scholar
10 Leboy PS . Regulating bone growth and development with bone morphogenetic proteins. Ann N Y Acad Sci2006;1068:14–18. Google Scholar
11 Chen D , ZhaoM, MundyGR. Bone morphogenetic proteins. Growth Factors2004;22:233–241. Google Scholar
12 Wonzey JM , RosenV. Bone morphogenetic protein and bone morphogenetic protein gene family in bone formation and repair. Clin Orthop Relat Res1998;346:26–37. Google Scholar
13 Hruska KA , MathewS, SaabG. Bone morphogenetic proteins in vascular calcification. Circ Res2005;97:105–114. Google Scholar
14 Castillo RC , BosseMJ, MacKenzieEJ, PattersonBM, LEAPStudy Group. Impact of smoking on fracture healing and risk of complications in limb-threatening open tibia fractures. J Orthop Trauma2005;19:151–157. Google Scholar
15 Kuper H , BoffettaP, AdamiHO. Tobacco use and cancer causation: association by tumor type. J Intern Med2002;252:206–224. Google Scholar
16 Gullihorn L , KarpmanR, LippielloL. Differential effects of nicotine and smoke condensate on bone cell metabolic activity. J Orthop Trauma2005;19:17–22. Google Scholar
17 Anderson T , ChristensenFB, LaursenM, et al.Smoking as a predictor of negative outcome in lumbar spinal fusion. Spine (Phila Pa 1976)2001;26:2623–2628. Google Scholar
18 Adams CI , KeatingJF, Court-BrownCM. Cigarette smoking and open tibial fractures. Injury2001;32:61–65. Google Scholar
19 Kwiatkowski TC , HanleyEN Jr, RampWK. Cigarette smoking and its orthopedic consequences. Am J Orthop1996;25:590–597. Google Scholar
20 Little CP , BurstonBJ, Hopkinson-WoolleyJ, BurgeP. Failure of surgery for scaphoid non-union is associated with smoking. J Hand Surg Br2006;31:252–255. Google Scholar
21 Ueng SW , LeeSS, LinSS, et al.Hyperbaric oxygen therapy mitigates the adverse effect of cigarette smoking on the bone healing of tibial lengthening: an experimental study on rabbits. J Trauma1999;47:752–759. Google Scholar
22 Adams CI , KeatingJF, Court-BrownCM. Cigarette smoking and open tibial fractures. Injury2001;32:61–65. Google Scholar
23 Harvey EJ , AgelJ, SelznickHS, ChapmanJR, HenleyMB. Deleterious effect of smoking on healing of open tibia-shaft fractures. Am J Orthop (Belle Mead NJ)2002;31:518–521. Google Scholar
24 Hoogendoorn JM, Van der Werken C. The adverse effects of smoking on healing of open tibial fractures. Ned Tijdschr Geneeskd 2002;146:1640–1644 (in Dutch). Google Scholar
25 Schmitz MA , FinneganM, NatarajanR, ChampineJ. Effect of smoking on tibial shaft fracture healing. Clin Orthop Relat Res1999;365:184–200. Google Scholar
26 Marsh DR , ShahS, ElliottJ, KurdyN. The Ilizarov method in nonunion, malunion and infection of fractures. J Bone Joint Surg [Br]1997;79-B:273–279. Google Scholar
27 Siegel HJ , PatzakisMJ, HoltomPD, ShermanR, ShepherdL. Limb salvage for chronic tibial osteomyelitis: an outcomes study. J Trauma2000;48:484–489. Google Scholar
28 Vestergaard P , MosekildeL. Fracture risk associated with smoking: a meta-analysis. J Intern Med2003;254:572–583. Google Scholar
29 Schmitz MA, Finnegan M, Champine J. The effect of smoking on the clinical healing of tibial shaft fractures. Procs 62nd Annual Meeting American Academy of Orthopaedic Surgeons, Florida, 1995. Google Scholar
30 Ward KD , KlesgesRC. A meta-analysis of the effects of cigarette smoking on mineral density. Calcif Tissue Int2001;68:259–270. Google Scholar
31 Gerdhem P , ObrantKJ. Effects of cigarette smoking on bone mass as assessed by dual-energy x-ray absorptiometry and ultrasound. Osteoporos Int2002;13:932–993. Google Scholar
32 Ortego-Centeno N , Munoz-TorresM, JodarE, et al.Effect of tobacco consumption on bone mineral density in healthy young males. Calcif Tissue Int1997;60:496–500. Google Scholar
33 Lissenberg-Thunnissen SN , de GorterDJ, SierCF, SchipperIB. Use and efficacy of bone morphogenetic proteins in fracture healing. Int Orthop2011;35:1271–1280. Google Scholar
34 Cho TJ , GerstenfeldLC, EinhornTA. Differential temporal expression of members of the transforming growth factor beta superfamily during murine fracture healing. J Bone Miner Res2002;17:513–520. Google Scholar
35 Gazzerro E , CanalisE. Bone morphogenetic proteins and their antagonists. Rev Endocr Metab Disord2006;7:51–65. Google Scholar
36 Gaston MS , SimpsonAH. Inhibition of fracture healing. J Bone Joint Surg [Br]2007;89-B:1553–1560. Google Scholar
37 El-Zawawy HB , GillCS, WrightRW, SandellLJ. Smoking delays chondrogenesis in a mouse model of closed tibial fracture healing. J Orthop Res2006;24: 2150-8. Google Scholar
38 Rajan RA , OngM, JonesS, FernandesJ. Does smoking affect the quality of bone regenerate in paediatric limb reconstructive surgery?J Child Orthop2007;1365-7. Google Scholar
39 Kyrö A , UseniusJP, AarnioM, KunnamoI, AvikainenV. Are smokers a risk group for delayed healing of tibial shaft fractures?Ann Chir Gynaecol1993;82:254–262. Google Scholar
40 Porter SE , HanleyEN Jr. The musculoskeletal effects of smoking. J Am Acad Orthop Surg2001;9:9–17. Google Scholar
41 Serena-Gómez E , PasseriLA. Complications of mandible fractures related to substance abuse. J Oral Maxillofac Surg2008;66:2028–2034. Google Scholar
42 Ma L , ShamMH, ZhengLW, CheungLK. Influence of low-dose nicotine on bone healing. J Trauma2011;70:E117–E121. Google Scholar
43 Ma L , ZwahlenRA, ZhengLW, ShamMH. Influence of nicotine on the biological activity of rabbit osteoblasts. Clin Oral Implants Res2011;22:338–342. Google Scholar
44 Yamano S , BerleyJA, KuoWP, et al.Effects of nicotine on gene expression and osseointegration in rats. Clin Oral Implants Res2010;21:1353–1359. Google Scholar
45 Giorgetti AP , César NetoJB, RuizKG, et al.Cigarette smoke inhalation modulates gene expression in sites of bone healing: a study in rats. Oral Surg Oral Med Oral Pathol Oral Radiol Endod2010;110:447–452. Google Scholar
46 Theiss SM , BodenSD, HairG, et al.The effect of nicotine on gene expression during spine fusion. Spine (Phila Pa 1976)2000;25:2588–2594. Google Scholar
47 Zheng LW , MaL, CheungLK. Changes in blood perfusion and bone healing induced by nicotine during distraction osteogenesis. Bone2008;43:355–361. Google Scholar
The authors would like to thank G. Dimakopoulos for his expert scientific assistance with data analysis.
No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.
