Abstract
Aims
Autologous chondrocyte implantation (ACI) is a promising treatment for articular cartilage degeneration and injury; however, it requires a large number of human hyaline chondrocytes, which often undergo dedifferentiation during in vitro expansion. This study aimed to investigate the effect of suramin on chondrocyte differentiation and its underlying mechanism.
Methods
Porcine chondrocytes were treated with vehicle or various doses of suramin. The expression of collagen, type II, alpha 1 (COL2A1), aggrecan (ACAN); COL1A1; COL10A1; SRY-box transcription factor 9 (SOX9); nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX); interleukin (IL)-1β; tumour necrosis factor alpha (TNFα); IL-8; and matrix metallopeptidase 13 (MMP-13) in chondrocytes at both messenger RNA (mRNA) and protein levels was determined by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and western blot. In addition, the supplementation of suramin to redifferentiation medium for the culture of expanded chondrocytes in 3D pellets was evaluated. Glycosaminoglycan (GAG) and collagen production were evaluated by biochemical analyses and immunofluorescence, as well as by immunohistochemistry. The expression of reactive oxygen species (ROS) and NOX activity were assessed by luciferase reporter gene assay, immunofluorescence analysis, and flow cytometry. Mutagenesis analysis, Alcian blue staining, reverse transcriptase polymerase chain reaction (RT-PCR), and western blot assay were used to determine whether p67phox was involved in suramin-enhanced chondrocyte phenotype maintenance.
Results
Suramin enhanced the COL2A1 and ACAN expression and lowered COL1A1 synthesis. Also, in 3D pellet culture GAG and COL2A1 production was significantly higher in pellets consisting of chondrocytes expanded with suramin compared to controls. Surprisingly, suramin also increased ROS generation, which is largely caused by enhanced NOX (p67phox) activity and membrane translocation. Overexpression of p67phox but not p67phoxAD (deleting amino acid (a.a) 199 to 212) mutant, which does not support ROS production in chondrocytes, significantly enhanced chondrocyte phenotype maintenance, SOX9 expression, and AKT (S473) phosphorylation. Knockdown of p67phox with its specific short hairpin (sh) RNA (shRNA) abolished the suramin-induced effects. Moreover, when these cells were treated with the phosphoinositide 3-kinase/protein kinase B (PI3K/AKT) inhibitor LY294002 or shRNA of AKT1, p67phox-induced COL2A1 and ACAN expression was significantly inhibited.
Conclusion
Suramin could redifferentiate dedifferentiated chondrocytes dependent on p67phox activation, which is mediated by the PI3K/AKT/SOX9 signalling pathway.
Cite this article: Bone Joint Res 2022;11(10):723–738.
Article focus
-
This study aimed to investigate the effects of suramin on chondrocyte differentiation maintenance, and its underlying molecular mechanism.
Key messages
-
Suramin treatment induced the upregulation of the collagen, type II, alpha 1 (COL2A1); aggrecan (ACAN); and SRY-box transcription factor 9 (SOX9), and downregulation of COL1A1, contributing to the differentiation of chondrocytes.
-
However, suramin treatment enhanced the generation of reactive oxygen species (ROS) which is largely caused by nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX2)/p67phox.
-
The redifferentiation of dedifferentiation chondrocytes under in vitro expansion was associated with an increase in expression of p67phox in chondrocytes.
Strengths and limitations
-
Our study may provide a new therapeutic option for improving chondrocyte phenotype maintenance.
-
The effects of suramin on chondrocyte phenotype maintenance were not tested in an in vivo animal model.
Introduction
It is known that articular cartilage defects have difficulty healing spontaneously due to limited tissue vascularization and a shortage of resident progenitor stem cells.1 Treatment strategies that aim to reconstruct articular tissue have been developed, such as autologous chondrocyte implantation (ACI), microfracture, and mosaicplasty.2 ACI for cartilage regeneration requires an adequate quantity of chondrocytes. Thus, in vitro monolayer expansion is required, and has been extensively adopted in order to apply this treatment. However, during in vitro expansion chondrocytes lose their phenotype, senescence, and dedifferentiate with serial passages, causing a substantial barrier to obtaining enough hyaline chondrocytes for transplantation. Furthermore, a previous study has demonstrated a “dedifferentiated-like” phenotype that might lead to chondrocyte degeneration.3 However, little is known about the mechanisms underlying dedifferentiation.
Senescence and dedifferentiation of chondrocytes during monolayer culture are accompanied by decreased expression of matrix proteins such as type II collagen (COL II) and aggrecan (ACAN), which are regulated by several growth and transcription factors such as insulin-like growth factor 1 (IGF-1), transforming growth factor-β (TGF-β), bone morphogenetic protein 2 (BMP-2), and SRY-box transcription factor 9 (SOX9).4,5 Conversely, the levels of type I collagen (COL1A), matrix metallopeptidase 1 (MMP1), MMP3, MMP13, type X collagen (Col X), and interleukin-1β (IL-1β) are upregulated during the inhibition of the normal molecular function of chondrocytes.6,7 In addition, histone deacetylases (HDACs) (epigenetic factors), epigenetically regulate chromatin remodelling, and transcription factor activity have been implicated in mediating chondrocyte phenotype. For example, HDAC activity in articular chondrocytes (ACs) decreases during dedifferentiation induced by serial monolayer culture, and another report reveals that overexpression of HDAC4 in proliferating chondrocytes suppresses hypertrophy and ossification of developing bones.8 Further, overexpression of microRNA (miR)-486 markedly downregulates the expression of sirtuin 6 (SIRT6) (class III HDACs), and leads to upregulating the expression of ADAMTS4 and MMP-13 and downregulating the expression of COL2A1 and ACAN, consequently leading to catabolic phenotype in human osteochondroma cell line SW1353.9
Multiple studies have demonstrated that the intracellular redox status of chondrocytes plays an important role in the regulation of chondrocyte differentiation and chondrogenesis. In general, reactive oxygen species (ROS) and reactive nitrogen species (RNS) are the main factors that affect intracellular redox status. When redox homeostasis is disrupted, overproduction of ROS leads to oxidative stress, which has long been regarded as a critical factor in the induction of chondrocyte senescence and apoptosis in osteoarthritis (OA).10,11 Many recent studies have revealed that the physiological levels of ROS act as an important signalling messenger in chondrocyte differentiation and metabolism.12,13 The particular role of redox levels in articular cartilage remains unclear, and the mechanisms behind ROS signalling pathways has yet to be fully investigated.
The major ROS produced by chondrocytes are superoxide (O2−), hydrogen peroxide (H2O2), nitric oxide (NO), and peroxynitrite, a reaction product of O−2 and NO.14 The nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) enzyme family is the main enzymatic source of O2 and H2O2. NOX isoforms include NOX1, NOX2, NOX3, NOX4, NOX5, dual oxidase 1 (DUOX1), and DUOX2.15 Chondrocytes express NOX2 and NOX4. Of these combinations, the NOX2 complex is composed of two membrane-bound subunits (p22phox and gp91phox), various cytosolic proteins (p40phox, p47phox, and p67phox), and Rac1 GTPase. In unstimulated conditions, the complex is latent, with unassembled subunits located in the cytosol and plasma membranes. Upon stimulation, the cytosolic components p47phox, p67phox, p40phox, and Rac2 translocate to the plasma membrane and associate with p22phox. Previous studies have shown that ROS produced by NOX2 and NOX4 are involved in chondrocyte differentiation.16,17 NOX4 is required early in cartilage differentiation, and ROS produced by NOX1 may play a major role in chondrocyte terminal differentiation.13 In addition, NOX2 has also been demonstrated in chondrocyte cell death mediated by IL-1β18 and NOX4 in IL-1β stimulation of extracellular matrix (ECM) destruction enzyme expression.17 Hence, ROS derived from NOX2 can be said to play a role in promoting ECM production, whereas NOX-2 does not seem to reduce ECM production.12 These results proved that early chondrocyte differentiation and hypertrophy were stimulated by the expression of NOX and were dependent on the cellular context.
Suramin is a highly sulphonated compound that is also known as a historic drug for the treatment of African sleeping sickness. Suramin has been reported to have several pharmacological effects, including anticancer, hepatoprotective, antioxidative, and relieving pathological pain.15,17-19 It was also reported that suramin attenuated cartilage destruction in a rat model of rheumatoid arthritis by inhibiting proinflammatory cytokine production and protecting against cartilage damage in a papain-induced mouse model.13,14 The chondroprotective effect appears to be mediated by a functional increase in tissue inhibitor of metalloproteinase 3 (TIMP-3) and a subsequent decrease in the activity of catabolic enzymes.19 Our recent study demonstrated that suramin suppressed IL-1β-induced apoptosis, and downregulated MMP-3, MMP-13, a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), and ADAMTS-5, while upregulating COL2A1 and ACAN in IL-1β-treated disc nucleus pulposus (NP) cells.20 The morphological changes in chondrocytes during dedifferentiation resemble those occurring in OA chondrocytes, where chondrocytes undergo hypertrophic terminal differentiation, which features chondrocyte hypertrophic change, and eventually apoptosis. Our findings indicate that suramin may also be a potential agent for improving chondrogenic properties for the phenotypic maintenance of chondrocytes during in vitro expansion.
Articular cartilage lesions undergo self-healing with great difficulty, owing to their avascular nature and aneural structural organization. Several surgical techniques such as microfracture, osteochondral transplantation (OCT), ACI, and matrix-associated autologous chondrocyte implantation (MACI) procedures have been demonstrated to be at least partially effective treatments of cartilage injury.21 Until now, ACs have been the cell source for cartilage repair. Problematically, due to serial culture, AC dedifferentiation takes place, which may result in fibrocartilaginous tissue formation. In this study, we investigated the effect of suramin on ACs in cartilage cell therapies by detecting chondrogenic properties, including the expression of cartilage-related genes such as ACAN, SOX9, COL2A1, and COL1A1. In addition, we investigated redox signals that have been implicated in the regulation of suramin’s ability to promote the maintenance phenotype of chondrocytes.
Methods
Porcine chondrocyte isolation
All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Kaohsiung Medical University. Primary ACs were harvested from the articular cartilage (AC) of the femoral condyles of skeletally mature (6 to 8 m) male pigs. The harvested AC blocks were digested with 1.5 mg/ml collagenase type II in Dulbecco’s Modified Eagle Medium-F12 (DMEM-F12) containing 10% foetal calf serum (FCS) at 37°C. Isolated chondrocytes were expanded using DMEM-F12 medium supplemented with 50 units/ml of penicillin, 50 µg/ml of streptomycin, and 10% FBS. An ARRIVE checklist is included in the Supplementary Material to show that the ARRIVE guidelines were adhered to in this study.
Western blot
We followed the standard instructions.22 The following primary antibodies were used: COL2A1 primary antibodies (1:1,000), ACA (1:1,000), COL10A1 (Abcam, UK) (1:1,000), NOX1 (1:1,000), NOX2 (1:1,000), NOX4 (1:1,000) (all ProteinTech Group, USA), p67phox (1:1,000) (Abclonal), phospho-extracellular signal-regulated kinase 1/2 (p-ERK1/2) (1:1,000; Cell Signaling Technology, USA), p-p38 (1:1,000; MyBioSource, USA), p-JNK (1:1,000; MyBioSource), ERK1/2 (1:1,000; Cell Signaling Technology), JNK (1:1,000; MyBioSource), and p38 (1:1,000; MyBioSource). The secondary antibody (1:5,000) was anti-rabbit peroxidase-conjugated (Jackson ImmunoResearch Europe, UK) and the chemiluminescence substrate was ECL Advance (GE Healthcare, USA). Abundance was quantified using Image-Pro Plus 6.0 software (Media Cybernetics, USA). Protease and phosphatase inhibitors were purchased from BIOTOOLS (Taiwan).
RNA isolation and real-time PCR
Total RNA was extracted using the RNAzol or TOOLSmart RNA Extractor reagent (BIOTOOLS). Purified total RNA (2 μg) was reverse-transcribed using the Thermo Scientific Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) or TOOL SQuant (BIOTOOLS, Taiwan) according to the manufacturer’s instructions. SYBR quantitative polymerase chain reaction (qPCR) was performed using the SYBR Green qPCR Mix (BIOTOOLS) kit and was processed on a LightCycler PCR and detection system (Roche Diagnostics, USA). Each reaction (20 μl) was run in duplicate and contained 1 μl of complementary DNA (cDNA) template along with the following primer sequences: Col2a1, forward (ACTCCTGGCACGGATGGTC) and reverse (CTTTCTCACCAACATCGCCC); Acan, forward (CCCAACCAGCCTGACAACTT) and reverse (CCTTCTCGTGCCAGATCATCA); Col10a1, forward (TGAACTTGGTTCATGGAGTGTTTTA) and reverse (TGCCTTGGTGTTGGATGGT); Col1a, forward (CTGGTACGGCGAGAGCATGACC) and reverse (GGAGGAGCAGGGCCTTCTTGAG); and glyceraldehyde 3-phosphate dehydrogenase (Gapdh), forward (TCACGACCATGGAGAAGGCT) and reverse (CAGGAGGCATTGCTGATGATC). Cycling parameters were 95°C for 15 minutes to activate DNA polymerase, followed by 40 cycles of 95°C for 15 seconds, 60°C for 20 seconds, and 72°C for 30 seconds. Melting curves were generated at the end of the reaction. Threshold cycles (Ct) for each gene tested were normalized to the housekeeping GAPDH gene value (ΔCt), and every experimental sample was referred to as the control (ΔΔCt). Fold change values were expressed as 2−ΔΔCt values.
Reverse transcriptase polymerase chain reaction
Reverse transcriptase polymerase chain reaction (RT-PCR) was performed according to the manufacturer’s instructions with a slight modification. The mixture contained 3 μg total RNA, 2.5 μM oligo(dT), 1.5 mM magnesium chloride (MgCl2), 0.01 M dithiothreitol, and 200 units of SuperScript III reverse transcriptase in a total volume of 20 μl. The RT steps consisted of a RT step (42°C for 60 minutes) and a denaturation step (70°C for five minutes). The PCR steps consisted of a denaturation step (95°C for 30 seconds), a primer annealing step (60°C for 30 seconds), and an elongation step (72°C for 30 seconds) for 30 cycles. In the final step, the duration of the elongation step was seven minutes. Finally, the samples were loaded onto a 1% agarose gel. The gels were then observed and photographed under ultraviolet light. The primers used were as follows: Nox1, sense primer 5′-CCATTCATATTCGAGCAGCAGG -3′ and antisense primer 5′-AACATCCTCACTGACAGTGCC-3′; Nox2, sense primer 5′-TTGGCGATCTCAGCAGAAGG-3′ and antisense primer 5′-GAGGTCAGGGTGAAAGGGTG-3′; Nox4, sense primer 5′-TGGAACGCACTACCAGGATGTC-3′ and antisense primer 5′- TGGAACGCACTACCAGGATGTC-3′; p47, sense primer 5′-CCTGTCTGAGAAGCTGGTCTACC-3′ and antisense primer 5′-GCGCGCTGCAGTATTCACTG-3′; p67, sense primer 5′-GAAGTCTGAGCCGAGACATTCC-3′ and antisense primer 5′-AGCCCGAGAAGCTGTCTTGATC-3′; and Gapdh, sense primer 5′- TCACGACCATGGAGAAGGCT-3′ and antisense primer 5′- CAGGAGGCATTGCTGATGATC-3′. Gapdh messenger RNA (mRNA) expression was used as an internal control.
Pellet cultures and chondrocyte redifferentiation
To perform pellet culture, a method described by Kato et al23 was used. Briefly, pellet cultures were prepared by adding 1 × 106 cells in 15 ml conical polypropylene (PE) centrifuge tubes. The cells were pelleted by centrifugation at 400× g for five minutes at room temperature. The pellets were maintained in chondrogenic differentiation medium (DMEM-F12 supplemented with 10% FBS, 2% insulin-transferrin-selenium-ethanolamine, and 1% penicillin/streptomycin) without (control) or with the addition of 10 μM suramin. The pellets were cultured for four weeks, and were then collected for subsequent histological and immunofluorescence staining.
Total glycosaminoglycans quantification
Total sulphated glycosaminoglycan (GAG) content was determined in cell pellet by using 1,9-dimethylmethylene blue (DMMB; Polysciences). Chondroitin sulphate C from shark cartilage was used as a standard. Briefly, harvested pellets were digested at 56°C overnight with 0.1 M proteinase K in PBE buffer (100 mM Na2HPO4; 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.5; 10 mM Tris, pH 6.5), and 100 μl of the digested sample was combined with 1 ml dimethylmethylene blue dye solution, and the absorbance was measured at 656 nm. DNA was measured using Hoechst 33,258 dye (Thermo Fisher Scientific). Briefly, 10 μl of the digested sample was combined with 200 μl Hoechst dye solution (0.7 μg/ml). Fluorescence measurements were taken with an excitation wavelength of 340 nm and emission wavelength of 465 nm. A standard curve was generated using calf thymus DNA. The GAG content was normalized against the amount of DNA measured in each sample.
Immunohistochemistry
Pellet sections were fixed in 4% paraformaldehyde (ten minutes, room temperature (RT)) and washed in phosphate-buffered saline (PBS). Then, 5 µm thick sections were stained with 1% (w/v) Alcian blue 8 GX, in addition, and after blocking endogenous tissue peroxidase activity with 0.3% H2O2 (ten minutes, RT). Pellet sections were incubated with monoclonal mouse antibodies (mABs) against collagen type I diluted in 1:100 or collagen type II (1:100) (16 to 18 hours, 4°C). Then pellet sections were washed in washing buffer and incubated with a biotinylated horse-antirabbit immunoglobulin G (IgG) (Vector Laboratories, USA) (30 minutes, RT). Afterwards pellet sections were incubated with avidin-biotin-peroxidase complex (ABC; Abcam, USA). After repeated washing, the 3,3′-diaminobenzidine tetrahydrochloride (DAB) (Vector Laboratories) was added continuously for approximately four minutes without light. The reaction was stopped with aqua dest, and then the sections were counterstained with haematoxylin. Representative images were obtained using a microscope (NIKON Ti-U; EINST Technology, Singapore).
ROS detection
Non-fluorescent 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) can be oxidized by ROS to highly fluorescent 2',7'-dichlorofluorescein (DCF). The chondrocytes were pretreated with 10 μM apocynin, 50 μM rotenone, 10 μM diphenyleneiodonium chloride (DPI), or vehicle combined with or without 10 μM suramin. The cells were then incubated with 100 μM DCFH-DA in DMEM for 30 minutes at 37°C and washed with ice-cold PBS to quantify the fluorescence emitted from the fluorescent DCF using a fluorescence-activated cell sorter (FACScan; Becton Dickinson, USA), or by detection of the fluorescence by fluorescence microscopy at 488 nm excitation and 525 nm emission. Finally, photographs were taken using a fluorescence microscope equipped with a digital camera (NIKON Ti-U). For quantitative analysis of the fluorescence intensity, six image fields from each treatment were randomly selected, and the relative fluorescence intensity was measured using Image-Pro Plus 6.0.
Determination of NOX activity
Cells (2 × 105) were trypsinized and harvested by centrifugation at 400× g for ten minutes at 4°C and resuspended in ice-cold DMEM after treatment. The cells (2 × 104) were then added to prewarmed (37°C) DMEM containing 1 μM NADPH and 20 μM lucigenin to a final 600 μl volume to initiate the reaction, followed by immediate measurement of chemiluminescence using a chemiluminescence analyzer. Chemiluminescence was measured continuously at one-minute intervals for 15 minutes. The activity of NOX is expressed as counts per million cells.
DNA constructs, transient transfection, and reporter gene assay
The full-length cDNAs of porcine p67phox genes were amplified by PCR. The PCR products were digested with EcoRI/XbaI to generate fragments that were then ligated into the pcDNA3.1/myc-His expression vector containing the cytomegalovirus (CMV) promoter and validated by sequencing. The porcine NOX2 and p67phox promoters from -1,000 to +1 bp were cloned by PCR using specific primers (p67phox sense: 5-AGA TCT GAG ATC CCT GTG TGC-3, antisense: 5-CCA TGG TCT TTT TAA AAA TTA TTT TTC C-3; NOX2 sense: 5-AGA TCT TGT TGG GTG TGA TTT TGA AT-3, antisense: 5-CCA TGG AGAAATTAGCAAATCATT-3) with porcine genomic DNA from porcine chondrocytes as a template. PCR products were cloned into the T&A cloning vector (Yeastern Biotech) and then confirmed by DNA sequencing. After digestion with BglII and NcoI, the fragments were subcloned into the pGL3-basic vector (Promega, USA). The primers used to construct the △AD (amino acid (a.a) 199 to 212), △AD (a.a 199 to 212), sense: 5’ GCCAAGAAGGATTACAGCTTCTCGGGCTTTGCCCC 3’, antisense: 5’GGGGCAAAGCCCGAGAAGCTGTAATCCTTCTTGGC 3’). Site-directed mutagenesis was performed using the Agilent QuikChange site-directed mutagenesis kit (Agilent Technologies, USA) and confirmed by sequencing. The pLKO.1-p67-short hairpin (sh) RNA (shRNA), which targets the porcine p67 gene sequence 5-GCCAAGAAGGAGGAATGGAAA-3, and luciferase control (pLKO.1-shLuc) plasmid constructs were kindly obtained from the National RNAi Core Facility located at the Institute of Molecular Biology/Genomic Research Centre, Academia Sinica (Taiwan), supported by the National Research Programme for Genomic Medicine Grants of the National Science Council (NSC97-3112-B-001-016). Transfection was performed using Lipofectamine 2000 reagent according to the manufacturer’s instructions with slight modifications. Chondrocytes were subcultured in a 12-well plate for 24 hours before transfection at a density of 8 × 104 cells in 0.5 ml of fresh culture medium per well. For use in the transfection assay, plasmids were mixed with Lipofectamine 2000 reagent in Opti-MEM (Thermo Fisher Scientific) and incubated at room temperature for 20 minutes. Cells were incubated in the mixture for a further 48 hours, and then lysed to measure luciferase activity as described previously.24 Luciferase activity was measured and normalized to the amount of total protein.
Immunofluorescence analysis
Chondrocytes were transfected with pEGFP-p67 expression plasmid or incubated with or without 10 μM suramin for 24 hours and then plated on glass coverslips. The cells were washed and fixed with 4% paraformaldehyde for 20 minutes at room temperature, permeabilized with 0.2% Triton X-100, and then blocked with 10% FBS in PBS. The cells were then stained with anti-COL2A1 (1:200) (Proteintech Group) and COL10A1 (Abcam) (1:200) antibody. Images were captured using a fluorescence microscope (NIKON Ti-U).
Stable p67phox-silencing early passage (P2) chondrocyte transfectants
A total of 293 T cells (8 × 106) were incubated in 10 cm petri dishes coated with poly-l-lysine for 24 hours to package lentiviral vectors. TransIT-LT1 reagent (45 μl) in Opti-MEM (750 μl) was mixed with the packaging vector pCMV-ΔR8.91 (6.75 μg), the envelope vector pMD.G (0.75 μg), and the transfer vector pLKO.1-p67-shRNA (7.5 μg) or pLKO.1-shluc (7.5 μg). After incubation at room temperature for 20 minutes, the plasmid-containing mixture was transferred to 293 T cells for 16 hours. After 1% (w/v) bovine serum albumin-containing medium was added for two days, the supernatant of the cultured cells was harvested. The media containing lentiviral vectors were centrifuged at 2,500 rpm for ten minutes, and the viral supernatants were passed through 0.45 μm filters and stored at -80°C. P3 chondrocytes (5 × 105) were cultured on 6 cm petri dishes with 4 ml medium, followed by infection with the harvested lentiviral supernatants (1 ml) and polybrene (8 μg/ml) for 24 hours. The infected cells were incubated in 2 μg/ml puromycin-containing medium for selection of stable p67phox-silencing primary chondrocyte transfectants.
Statistical analysis
Each result in this study is from at least three independent experiments. Significant differences were evaluated using the independent-samples t-test. All values are displayed as means and standard deviations (SDs) for three determinations (p < 0.05; p < 0.01; p < 0.001 compared with vehicle). Statistical significance was set at p < 0.05.
Results
Chondrocytes expanded in a suramin-containing medium acquire enhanced redifferentiation capacity
We assessed whether exposure to suramin preserved chondrogenic properties in ACs. As shown in Figures 1a and 1b, exposure of chondrocytes (P3 passage) to suramin resulted in a time- and dose-dependent increase in the protein expression of COL2A1 and ACAN. The expression of ACAN was rapidly elevated as early as one hour and continuously for at least one week (data not shown), and the protein expression of COL2A1 was also increased at eight hours and was sustained for up to one week (data not shown) after suramin administration. In contrast, the protein expression of COL10A1 decreased in a dose-dependent manner after chondrocyte treatment. Using real-time PCR, Col2a1 and Acan transcripts were transiently increased by suramin at eight and 16 hours, to evaluate the redifferentiation capacity of expanded chondrocytes. The earlier and later passages of chondrocytes from P1 and P6 were used, and chondrogenic (COL2A1 and ACAN) and dedifferentiation (COL1A and COL10A1) markers were investigated. As shown in Figures 1d to 1f, the mRNA and protein levels of COL2A1 and ACAN were dramatically reduced from passages P1 to P6. Despite a sharp decrease in COL2A1 and ACAN expression levels in chondrocytes from passages P1 to P6, the mRNA and protein expression levels of COL2A1 and ACAN were significantly higher when P1 and P6 chondrocytes were incubated with suramin for seven days. Regarding the dedifferentiation marker, the mRNA levels of Col1a and Col10a1 were detected in the passaged chondrocytes. In the earlier passage (P1), the expression of Col1a and Col10a1 was significantly lower in the chondrocytes than in the later passage (P6). However, the mRNA expression levels of Col1a1 and Col10a1 were perceptibly reduced when P1 and P6 chondrocytes were coincubated with suramin at day 7. Furthermore, the ratios of COL2/COL1, which represent the degree of dedifferentiation, were also quantified.25 High values of these ratios revealed an advantageous status of differentiation (of native healthy cartilage), whereas low values indicated dedifferentiated cells.26 As shown in Figure 1f, the ratios of COL2/COL1 were clearly increased in suramin administration of chondrocytes, regardless of the earlier passage (P1) or later passage cells (P6). To confirm the above data, immunofluorescence was used to detect the expression of COL2A1 and COL10A1 on day 7. As shown in Figure 1g, expanded chondrocytes from P1 and P6 yielded a higher chondrogenic index (COL2A1), whereas the chondrocytes from P1 and P6 exhibited a lower dedifferentiation index (COL10A1) after a seven-day incubation with suramin. Further, to investigate the chondrogenic potential of suramin on redifferentiation of expanded chondrocytes, we performed 3D pellet culture using P3 chondrocytes, and the pellets were cultured with or without the supplement of the suramin in chondropermissive medium for 28 days. Glycosaminoglycan (GAG) and collagen production were evaluated by quantitative biochemical analyses (DMMB assay), Alcian blue staining, as well as immunohistochemistry. The results were as shown in Figures 1g and 1h; after 28 days of subsequent 3D pellet culture, GAG and proteoglycan production was significantly higher in pellets of chondrocytes that were expanded in the presence of suramin compared to controls as shown by the DMMB assay and Alcian blue staining. Additionally, pellets cultured under supplementation with suramin (10 μM) also revealed a stronger staining for COL2A1 when compared to the control group. Conversely, immunofluorescence staining and immunohistochemistry revealed a slight decrease in COL1A1 production in suramin administration pellets (Figure 1i). Collectively, these results indicate that chondrocytes expanded in the presence of suramin maintain their redifferentiation potential.
Fig. 1
Suramin-induced superoxide generation originates from NADPH oxidase
Many studies have demonstrated that the redox status of chondrocytes plays an essential role in the regulation of chondrocyte differentiation and chondrogenesis.13,16,27 ROS are also suggested to be potential mediators of suramin-regulated signalling.28,29 Further elucidation of their roles in suramin enhanced the redifferentiation capacity and induced signalling. Using DCFH-DA as an indicator, cells were stimulated with different doses of suramin for various time periods and their ROS production was detected by fluorescence microscopy and flow cytometry, respectively. The results showed that suramin induced a rapid increase in ROS production up to 10 mins after stimulation (Figure 2a). We found that suramin-induced ROS generation in a time- and dose-dependent manner (Figures 2a and 2b) and ROS production were significantly suppressed by the NOX inhibitor DPI, an NADPH oxidase inhibitor, and apocynin (Figures 2d and 2f),30 but not by allopurinol (xanthine oxidase inhibitor) and rotenone (mitochondrial complex I inhibitor) (data not shown). Therefore, we hypothesized that the major source of O−2 production in response to suramin might be NOX. As shown in Figure 2e, the NOX oxidase activity was induced by suramin to a peak at ten minutes and was sustained for at least one hour.
Fig. 2
Superoxide mediates suramin-induced differentiation of chondrocytes
To determine which members of the NOX family might be responsible for suramin-induced ROS generation in chondrocytes, we examined the abundance of various NOX family members by RT-PCR and western blot analysis. The genes for Nox1, Nox2, and Nox4, as well as those for the cytosolic components p47phox and p67phox were expressed in chondrocytes (Figure 3a). In contrast, Nox3 and Nox5 were not detected at all (data not shown). The mRNA and protein levels of NOX2, NOX4, and p67phox were increased after the suramin incubation of chondrocytes (Figures 3a and 3b). These changes in Nox1, Nox2, and Nox4 gene expression were confirmed by real-time qPCR analysis (Figure 3c). To determine whether suramin controls the transcriptional activity of NOX2 and p67, a reporter containing 1.0 kb of the porcine NOX2 and p67phox promoter (-1,000 to +1 bp) fused with the firefly luciferase gene was constructed, as described in the Methods section. Then, we transiently transfected the reporter into chondrocytes and measured its promoter activity in response to suramin. As shown in Figures 3g and 3h, suramin induced NOX2 and p67phox promoter activity by approximately twofold in chondrocytes. Furthermore, chondrocytes were transiently transfected with expression vectors for wild-type p67phox tagged at its carboxy terminus with the green fluorescent protein epitope and plated onto coverslips. Immunofluorescence analysis of unstimulated cells revealed a pattern of staining indicative of a cytosolic distribution of ectopically expressed p67phox. No nuclear staining was evident, whereas only minor staining was observed on the periphery of the cell. Stimulation of cells with suramin produced a marked alteration in the cellular distribution of p67phox with a sharply defined edge to the cells, indicative of plasma membrane localization (Figure 3e). As expected, after treatment with suramin for 30 minutes, cytoplasmic p67phox is translocated from the cytosol to the membrane fraction (Figure 3f), which is consistent with the activation of NOX (Figure 2e). In addition, the enhanced effect of suramin on the expression of NOX2/p67phox was more obvious than that of NOX4. Therefore, we suggest that the major source of suramin-induced ROS production in chondrocytes might be NOX2/p67phox complex activation. As described above, suramin was shown to promote chondrocyte differentiation (Figure 1). Moreover, the role of O−2 in suramin-induced chondrocyte redifferentiation was explored. As shown in Figures 4a to 4d, western blot analysis revealed that suramin increased the protein expression of COL2A1 and ACAN, which are major chondrogenic marker genes. Pretreatment with NAC, DPI, and apocynin blocked suramin-induced O−2 production (Figures 2d and 2e), and inhibited suramin-induced increase in COL2A1 and ACAN expression (Figures 4a to 4c). Knockdown of the p67phox subunit by shRNA blocked the suramin-induced protein expression of COL2A1 and ACAN (Figure 4d). Together, these results suggest that suramin-induced ROS production generated by NOX2/p67phox activation is required for the cellular differentiation of chondrocytes.
Fig. 3
Fig. 4
p67phox are required for differentiation in primary chondrocytes
The role of p67phox in chondrocyte phenotype maintenance was further confirmed by determining the gene expression of chondrogenic differentiation markers in p67phox-depleted early passage (more differentiated) primary chondrocytes or overexpression of p67phox in late passage chondrocytes (less differentiated cells). Overexpression of p67phox in late passage chondrocytes (P6) markedly enhanced the protein and mRNA expression of COL2A1 and ACAN (Figure 5a). Furthermore, the senescence rate was significantly decreased (Figure 5c, left panel), and the production of proteoglycan stained by Alcian blue was significantly enhanced (Figure 5c, right panel). Conversely, knockdown of p67phox by its specific shRNA (pLKO.1-p67phox-shRNA) (shp67phox) in early passage chondrocytes (P2) suppressed the protein and mRNA expression of COL2A1 and ACAN (Figures 5b and 5d), proteoglycan production, and senescence percentage. Further, to investigate whether p67-mediated ROS generation is required for regulated chondrocyte phenotype, we used a p67phox mutant, p67phox (△AD), which cannot support ROS production,31 and transiently transfected with these mutant plasmids into chondrocytes, as shown in Figures 5e and 5f. The mean increased protein and mRNA level of COL2A1 and ACAN was obviously lower than the cells that transfected with the wild type form of p67phox (pcp67phox) (COL2A1, wild type p67phox transfected vs p67phox (△AD) : 2.1 (standard deviation (SD)) 0.1) vs 0.9 (SD 0.1); ACAN, wild type p67phox transfected vs p67phox (△AD) : 3.2 (SD 0.15) vs 2.0 (SD 0.12)). In addition, overexpression of p67phox in chondrocytes (P6), the protein and mRNA levels of MMP-3, IL-1β, IL-6, IL-8, and tumour necrosis factor alpha (TNFα), which are known regulators of dedifferentiation, were suppressed (Figures 6a and 6b); in contrast, knockdown of p67phox in chondrocytes (P2), the mRNA and protein expression of MMP-3, IL-1β, IL-6, IL-8, and TNFα were markedly upregulated (Figures 6c and 6d). These results indicate that p67phox potentiates chondrogenic differentiation in vitro.
Fig. 5
Fig. 6
p67phox-dependent modulation of the chondrocyte phenotype is AKT-dependent
Intracellular mitogen-activated protein kinases mitogen-activated protein kinases (MAPKs) and protein kinase B (AKT) are the major oxidative stress-sensitive signal transduction pathways that influence cell proliferation, survival, and differentiation.32 In addition, phosphoinositide 3-kinase (PI3K)-AKT signalling is a key regulator of cell survival in response to growth factor stimulation and promotes proteoglycan synthesis, type II collagen synthesis, SOX9 expression, and chondrocyte survival.33 We thus examined the phosphorylation of ERK1/2 and AKT. Immunoblot analysis revealed that phosphorylation of AKT and ERK1/2 was greatly increased in chondrocytes treated with suramin (data not shown), and the phosphorylation of AKT was obviously upregulated in cells overexpressing p67phox (Figure 7a). In contrast, phosphorylation of ERK in cells transfected with p67phox did not change compared with that in cells transfected with the control (Figure 7a). Therefore, we explored whether p67phox-induced differentiation effects were mediated through the PI3K/AKT pathway. Figures 7b and 7c, show that pretreatment with the PI3K inhibitor LY294002 could attenuate both suramin (data not shown) and p67phox-induced COL2A1 and ACAN expression in chondrocytes. Furthermore, knockdown of AKT1 by its specific shRNA in chondrocytes could decrease suramin (data not shown) and p67phox-induced COL2A1 and ACAN expression. Therefore, we suggest that p67phox generates ROS-mediated suramin-induced differentiation of chondrocytes by regulating the PI3K/AKT pathway.
Fig. 7
p67phox mediates maintenance of articular chondrocyte phenotypic stability through AKT-dependent SOX9 expression
We then investigated the question of which molecular mechanism links p67phox/PI3K/AKT signalling to the maintenance of phenotypic stability. It is known that SOX9 mediates anabolic signalling in human chondrocytes.34,35 Therefore, we tested the hypothesis that p67phox signalling supports SOX9 expression via AKT activation. Hence, we transfected wild-type p67phox (pcp67) into primary chondrocytes and found increased expression of SOX9 (Figure 8a). Pretreatment with the PI3K-specific pharmacological inhibitor LY294002 blocked p67phox-induced mRNA and protein expression of SOX9. These results suggest that p67 activates the PI3K/AKT pathway to increase SOX9 expression, thereby promoting the phenotype maintenance of chondrocytes.
Fig. 8
Discussion
ACI was first developed by Brittberg et al22 in 1994 and has been reported as a promising strategy for the clinical treatment of full-thickness cartilage defects. However, the insufficient cell number and gradual loss of phenotype of chondrocytes when expanded in vitro diminished its clinical application. Therefore, new therapeutic drugs are required that enhance the therapeutic applications.
In this study, we introduced suramin, a drug developed long ago, and investigated its molecular effect on the phenotype maintenance of chondrocytes cultured in vitro. As described in other reports, suramin treatment increased GAGs in the chondrogenic cell line ATDC5 micromass model of chondrogenesis and in pellet cultures of human ACs.36 In addition, suramin inhibits cartilage degradation in OA by increasing TIMP-3 levels.37 Our novel findings have further proved that suramin can promote the gene expression of COL2A1 and ACAN while downregulating the gene expression of COL1A1 and COL10A1 in both early and late passage chondrocytes (Figure 1). We suggest that suramin could prevent or delay chondrocyte dedifferentiation.
Furthermore, we demonstrated that suramin-induced NOX activation to produce ROS contributes to the phenotype maintenance of chondrocytes. Several previous studies have shown that ROS is considered a pathogenic factor in OA by regulating intracellular signalling, chondrocyte senescence and apoptosis, and matrix-degrading protease synthesis.38-41 For example, tert-butylhydroquinone (tBHQ) is a synthetic phenolic antioxidant that has potent antioxidant activities, and applying tBHQ demonstrated notably attenuated cartilage destruction in destabilization of the medial meniscus (DMM)-induced OA in vivo.42 Conversely, another study has demonstrated that wogonin induces mild generation of ROS, thereby regulating the cellular redox status causing the induction of NF-E2-related factor 2/antioxidant response element (Nrf2/ARE) pathways through activation of the ROS/ERK/Nrf2/HO-1-SOD2-NQO1-GCLC signalling axis in OA chondrocytes.43 In our recent report, we found that shockwave treatment enhanced ECM synthesis in ACs through activation of the ROS/MAPK/NRF2 signalling pathway.44 Furthermore, another study showed that increased stiffness and appropriate ROS production facilitates the chondrogenic differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) by activating the mechanistic target of rapamycin (mTOR) signalling pathway.45 Therefore, ROS are not categorically harmful, and therapeutics must consider the essential role of ROS levels.
In addition, we demonstrated that NOX2/p67phox activation is a major source of suramin-induced ROS production (Figure 3). Many studies have attested to the functional relationship between the NOX family and increased ROS generation in various cell types. For example, NOX4 is the main NOX enzyme involved in the early stages of haematopoietic differentiation from human-induced pluripotent stem cells.46 NOX4 is overexpressed in pre-adipocytes and participates in the differentiation of stem cells into adipocytes.47 Polyphyllin VII blocks the differentiation of bone marrow macrophages (BMMs) into osteoclasts by inhibiting ROS synthesis, which is regulated by the TRAF6-cSrc-PI3K signalling pathway, including Nox1 and Rac family small GTPase 1 (GTP-Rac1).48 Superoxide generation by the NR2B-NMDARs/RasGRF1/NOX2 pathway promotes dendritogenesis.49 We also proved that Nox2/p67phox is involved in suramin-induced chondrocyte redifferentiation. Collectively, these results indicate that the Nox family plays an important role in the phenotype maintenance of chondrocytes during in vitro culture expansion, and should be further examined. In the present study, suramin upregulated the promoter activation of NOX2 and p67phox (Figure 3). This indicates that suramin might regulate the biosynthesis of NOX2 and p67phox partially at the transcriptional level. However, compared with the fold change of Nox2 and p67phox mRNA after suramin treatment (Figures 3a and 3c; approximately 2.5- and 3-fold), this result highlighted that a mRNA stability regulation mechanism may be involved in the expression of NOX2 and p67phox. However, the molecular regulation should be further elucidated.
It is known that phosphate plays an important role in the regulation of chondrocyte proliferation and differentiation, as well as endochondral bone development. A previous study found that overexpression of mutated solute carrier family 20 member 2 (SLC20A2) gene enhances the expression of ACAN, COL2A1, and SOX9, and inhibits hypertrophic differentiation while decreasing inorganic phosphate (Pi) uptake in ATDC5 chondrocytes.50 Suramin is also known as a purinergic receptor (P2 receptor) inhibitor; in addition, purine receptors are important regulators of extracellular inorganic pyrophosphate (ePPi) production by chondrocytes. P1 receptor stimulation diminishes and P2 receptor stimulation enhances ePPi production, respectively. Hence, suramin decreases ePPi concentrations in porcine cartilage explants and chondrocyte monolayers.51 However, whether suramin enhanced the phenotype maintenance via regulation of extracellular phosphate concentration needs to be further investigated.
In this study, overexpression of p67phox could enhance the protein production of SOX9, COL2A1, and ACAN in chondrocytes. Further, we performed the DNA affinity precipitation assay and chromatin-immunoprecipitation assay and found that SOX9 protein binding to the Col2a1 promoter was increased after suramin administration for 24 hours in chondrocytes or in p67-overexpressed chondrocytes (Supplementary Figure a, right panel), which demonstrated that the process of suramin mediating the gene expression of Col2a1 was at least partially dependent on transcriptional level. Differently, we added cycloheximide to block de novo protein synthesis in disc nucleus pulposus (NP) cells (data not shown), and the protein degradation rate of COL2A1 and ACAN was slower in suramin-treated group compared to control group (Supplementary Figure a, left panel). It is suggested that suramin regulated the COL2A1 and ACAN expression in disc NP cells at least partially through post-translational modification. In addition, in the present study the PI3K/AKT pathway mediated p67-induced SOX9, COL2A1, and ACAN production. The PI3K/AKT pathway has been implicated in chondrocyte proliferation and survival,52,53 chondrogenic differentiation, hypertrophic maturation, and ECM deposition.54,55 As shown in Figure 7, overexpression of p67phox in chondrocytes activated AKT phosphorylation. This also shows that ROS can stimulate AKT phosphorylation in phagocytic and nonphagocytic cells.56,57 Another study reported that oxidative stress activates PI3K/AKT-dependent signalling via the inactivation of PTEN.58 Therefore, elucidating the crosstalk between the PI3K/AKT pathway and NOX2/p67phox activation requires further investigation.
In conclusion, our study provides evidence that in chondrocytes, suramin-increased Nox2/p67phox expression can promote complex activation to produce ROS release. The increased oxidative stress might inhibit PTEN to further activate the PI3K/AKT pathway and stimulate the expression of SOX9/COL2A/ACAN to promote phenotype maintenance of chondrocytes (Figure 9). These novel findings highlight that suramin can be an effective therapeutic strategy for cartilage repair in ACI applications.
Fig. 9
References
1. Candela ME , Yasuhara R , Iwamoto M , Enomoto-Iwamoto M . Resident mesenchymal progenitors of articular cartilage . Matrix Biol . 2014 ; 39 : 44 – 49 . Crossref PubMed Google Scholar
2. Frisbie DD , Bowman SM , Colhoun HA , DiCarlo EF , Kawcak CE , McIlwraith CW . Evaluation of autologous chondrocyte transplantation via a collagen membrane in equine articular defects: results at 12 and 18 months . Osteoarthritis Cartilage . 2008 ; 16 ( 6 ): 667 – 679 . Crossref PubMed Google Scholar
3. Charlier E , Deroyer C , Ciregia F , et al. Chondrocyte dedifferentiation and osteoarthritis (OA) . Biochem Pharmacol . 2019 ; 165 : 49 – 65 . Crossref PubMed Google Scholar
4. Benya PD , Padilla SR , Nimni ME . Independent regulation of collagen types by chondrocytes during the loss of differentiated function in culture . Cell . 1978 ; 15 ( 4 ): 1313 – 1321 . Crossref PubMed Google Scholar
5. Kawakami Y , Rodriguez-León J , Izpisúa Belmonte JC . The role of TGFbetas and Sox9 during limb chondrogenesis . Curr Opin Cell Biol . 2006 ; 18 ( 6 ): 723 – 729 . Crossref PubMed Google Scholar
6. Benya PD , Shaffer JD . Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels . Cell . 1982 ; 30 ( 1 ): 215 – 224 . Crossref PubMed Google Scholar
7. Kolettas E , Buluwela L , Bayliss MT , Muir HI . Expression of cartilage-specific molecules is retained on long-term culture of human articular chondrocytes . J Cell Sci . 1995 ; 108 ( Pt 5) : 1991 – 1999 . Crossref PubMed Google Scholar
8. Chen Z , Zhang Z , Guo L , et al. The role of histone deacetylase 4 during chondrocyte hypertrophy and endochondral bone development . Bone Joint Res . 2020 ; 9 ( 2 ): 82 – 89 . Crossref PubMed Google Scholar
9. Yang J , Zhou Y , Liang X , Jing B , Zhao Z . MicroRNA-486 promotes a more catabolic phenotype in chondrocyte-like cells by targeting SIRT6: possible involvement in cartilage degradation in osteoarthritis . Bone Joint Res . 2021 ; 10 ( 7 ): 459 – 466 . Crossref Google Scholar
10. Choudhary D , Adhikary S , Ahmad N , et al. Prevention of articular cartilage degeneration in a rat model of monosodium iodoacetate induced osteoarthritis by oral treatment with Withaferin A . Biomed Pharmacother . 2018 ; 99 : 151 – 161 . Crossref PubMed Google Scholar
11. Henrotin YE , Bruckner P , Pujol J-P . The role of reactive oxygen species in homeostasis and degradation of cartilage . Osteoarthritis Cartilage . 2003 ; 11 ( 10 ): 747 – 755 . Crossref PubMed Google Scholar
12. Funato S , Yasuhara R , Yoshimura K , et al. Extracellular matrix loss in chondrocytes after exposure to interleukin-1β in NADPH oxidase-dependent manner . Cell Tissue Res . 2017 ; 368 ( 1 ): 135 – 144 . Crossref PubMed Google Scholar
13. Ambe K , Watanabe H , Takahashi S , Nakagawa T . Immunohistochemical localization of Nox1, Nox4 and Mn-SOD in mouse femur during endochondral ossification . Tissue Cell . 2014 ; 46 ( 6 ): 433 – 438 . Crossref PubMed Google Scholar
14. Del Carlo M , Loeser RF . Nitric oxide-mediated chondrocyte cell death requires the generation of additional reactive oxygen species . Arthritis Rheum . 2002 ; 46 ( 2 ): 394 – 403 . Crossref PubMed Google Scholar
15. Cheng G , Cao Z , Xu X , van Meir EG , Lambeth JD . Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5 . Gene . 2001 ; 269 ( 1–2 ): 131 – 140 . Crossref PubMed Google Scholar
16. Kim KS , Choi HW , Yoon HE , Kim IY . Reactive oxygen species generated by NADPH oxidase 2 and 4 are required for chondrogenic differentiation . J Biol Chem . 2010 ; 285 ( 51 ): 40294 – 40302 . Crossref PubMed Google Scholar
17. Grange L , Nguyen MVC , Lardy B , et al. NAD(P)H oxidase activity of Nox4 in chondrocytes is both inducible and involved in collagenase expression . Antioxid Redox Signal . 2006 ; 8 ( 9–10 ): 1485 – 1496 . Crossref PubMed Google Scholar
18. Yoshimura K , Miyamoto Y , Yasuhara R , et al. Monocarboxylate transporter-1 is required for cell death in mouse chondrocytic ATDC5 cells exposed to interleukin-1beta via late phase activation of nuclear factor kappaB and expression of phagocyte-type NADPH oxidase . J Biol Chem . 2011 ; 286 ( 17 ): 14744 – 14752 . Crossref PubMed Google Scholar
19. McGeary RP , Bennett AJ , Tran QB , Cosgrove KL , Ross BP . Suramin: clinical uses and structure-activity relationships . Mini Rev Med Chem . 2008 ; 8 ( 13 ): 1384 – 1394 . Crossref PubMed Google Scholar
20. Liu Z-M , Lu C-C , Shen P-C , et al. Suramin attenuates intervertebral disc degeneration by inhibiting NF-κB signalling pathway . Bone Joint Res . 2021 ; 10 ( 8 ): 498 – 513 . Crossref PubMed Google Scholar
21. Binder H , Hoffman L , Zak L , Tiefenboeck T , Aldrian S , Albrecht C . Clinical evaluation after matrix-associated autologous chondrocyte transplantation: a comparison of four different graft types . Bone Joint Res . 2021 ; 10 ( 7 ): 370 – 379 . Crossref Google Scholar
22. Brittberg M , Lindahl A , Nilsson A , Ohlsson C , Isaksson O , Peterson L . Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation . N Engl J Med . 1994 ; 331 ( 14 ): 889 – 895 . Crossref PubMed Google Scholar
23. Kato Y , Iwamoto M , Koike T , Suzuki F , Takano Y . Terminal differentiation and calcification in rabbit chondrocyte cultures grown in centrifuge tubes: regulation by transforming growth factor beta and serum factors . Proc Natl Acad Sci U S A . 1988 ; 85 ( 24 ): 9552 – 9556 . Crossref PubMed Google Scholar
24. Liu ZM , Tseng HY , Tsai HW , Su FC , Huang HS . Transforming growth factor β-interacting factor-induced malignant progression of hepatocellular carcinoma cells depends on superoxide production from Nox4 . Free Radic Biol Med . 2015 ; 84 : 54 – 64 . Crossref PubMed Google Scholar
25. Marlovits S , Hombauer M , Truppe M , Vècsei V , Schlegel W . Changes in the ratio of type-I and type-II collagen expression during monolayer culture of human chondrocytes . J Bone Joint Surg Br . 2004 ; 86-B ( 2 ): 286 – 295 . Crossref PubMed Google Scholar
26. Martin I , Jakob M , Schäfer D , Dick W , Spagnoli G , Heberer M . Quantitative analysis of gene expression in human articular cartilage from normal and osteoarthritic joints . Osteoarthritis Cartilage . 2001 ; 9 ( 2 ): 112 – 118 . Crossref PubMed Google Scholar
27. Morita K , Miyamoto T , Fujita N , et al. Reactive oxygen species induce chondrocyte hypertrophy in endochondral ossification . J Exp Med . 2007 ; 204 ( 7 ): 1613 – 1623 . Crossref PubMed Google Scholar
28. Sauer H , Klimm B , Hescheler J , Wartenberg M . Activation of p90RSK and growth stimulation of multicellular tumor spheroids are dependent on reactive oxygen species generated after purinergic receptor stimulation by ATP . FASEB J . 2001 ; 15 ( 13 ): 2539 – 2541 . Crossref PubMed Google Scholar
29. Sciancalepore M , Luin E , Parato G , et al. Reactive oxygen species contribute to the promotion of the ATP-mediated proliferation of mouse skeletal myoblasts . Free Radic Biol Med . 2012 ; 53 ( 7 ): 1392 – 1398 . Crossref PubMed Google Scholar
30. Heumüller S , Wind S , Barbosa-Sicard E , et al. Apocynin is not an inhibitor of vascular NADPH oxidases but an antioxidant . Hypertension . 2008 ; 51 ( 2 ): 211 – 217 . Crossref Google Scholar
31. Han CH , Freeman JL , Lee T , Motalebi SA , Lambeth JD . Regulation of the neutrophil respiratory burst oxidase. Identification of an activation domain in p67(phox) . J Biol Chem . 1998 ; 273 ( 27 ): 16663 – 16668 . Crossref PubMed Google Scholar
32. Matsuzawa A , Ichijo H . Stress-responsive protein kinases in redox-regulated apoptosis signaling . Antioxid Redox Signal . 2005 ; 7 ( 3–4 ): 472 – 481 . Crossref PubMed Google Scholar
33. Yin W , Park JI , Loeser RF . Oxidative stress inhibits insulin-like growth factor-I induction of chondrocyte proteoglycan synthesis through differential regulation of phosphatidylinositol 3-Kinase-Akt and MEK-ERK MAPK signaling pathways . J Biol Chem . 2009 ; 284 ( 46 ): 31972 – 31981 . Crossref PubMed Google Scholar
34. Bi W , Deng JM , Zhang Z , Behringer RR , de Crombrugghe B . Sox9 is required for cartilage formation . Nat Genet . 1999 ; 22 ( 1 ): 85 – 89 . Crossref PubMed Google Scholar
35. Han Y , Lefebvre V . L-Sox5 and Sox6 drive expression of the aggrecan gene in cartilage by securing binding of Sox9 to a far-upstream enhancer . Mol Cell Biol . 2008 ; 28 ( 16 ): 4999 – 5013 . Crossref PubMed Google Scholar
36. Guns L-A , Monteagudo S , Kvasnytsia M , et al. Suramin increases cartilage proteoglycan accumulation in vitro and protects against joint damage triggered by papain injection in mouse knees in vivo . RMD Open . 2017 ; 3 ( 2 ): e000604 . Crossref PubMed Google Scholar
37. Chanalaris A , Doherty C , Marsden BD , et al. Suramin inhibits osteoarthritic cartilage degradation by increasing extracellular levels of chondroprotective tissue inhibitor of metalloproteinases 3 . Mol Pharmacol . 2017 ; 92 ( 4 ): 459 – 468 . Crossref PubMed Google Scholar
38. Yu SM , Kim SJ . Withaferin A-caused production of intracellular reactive oxygen species modulates apoptosis via PI3K/Akt and JNKinase in rabbit articular chondrocytes . J Korean Med Sci . 2014 ; 29 ( 8 ): 1042 – 1053 . Crossref PubMed Google Scholar
39. Rao Z , Wang S , Wang J . Peroxiredoxin 4 inhibits IL-1β-induced chondrocyte apoptosis via PI3K/AKT signaling . Biomed Pharmacother . 2017 ; 90 : 414 – 420 . Crossref PubMed Google Scholar
40. Yu SM , Kim SJ . The thymoquinone-induced production of reactive oxygen species promotes dedifferentiation through the ERK pathway and inflammation through the p38 and PI3K pathways in rabbit articular chondrocytes . Int J Mol Med . 2015 ; 35 ( 2 ): 325 – 332 . Crossref PubMed Google Scholar
41. Zuo D , Tan B , Jia G , Wu D , Yu L , Jia L . A treatment combined prussian blue nanoparticles with low-intensity pulsed ultrasound alleviates cartilage damage in knee osteoarthritis by initiating PI3K/Akt/mTOR pathway . Am J Transl Res . 2021 ; 13 ( 5 ): 3987 – 4006 . Crossref PubMed Google Scholar
42. Zhang H , Li J , Xiang X , et al. Tert-butylhydroquinone attenuates osteoarthritis by protecting chondrocytes and inhibiting macrophage polarization . Bone Joint Res . 2021 ; 10 ( 11 ): 704 – 713 . Crossref PubMed Google Scholar
43. Khan NM , Haseeb A , Ansari MY , Devarapalli P , Haynie S , Haqqi TM . Wogonin, a plant derived small molecule, exerts potent anti-inflammatory and chondroprotective effects through the activation of ROS/ERK/Nrf2 signaling pathways in human osteoarthritis chondrocytes . Free Radic Biol Med . 2017 ; 106 : 288 – 301 . Crossref PubMed Google Scholar
44. Shen P-C , Chou S-H , Lu C-C , et al. Shockwave Treatment Enhanced Extracellular Matrix Production in Articular Chondrocytes Through Activation of the ROS/MAPK/Nrf2 Signaling Pathway . Cartilage . 2021 ; 13 ( 2_suppl ): 238S – 253S . Crossref PubMed Google Scholar
45. Zheng L , Liu S , Cheng X , et al. Intensified stiffness and photodynamic provocation in a collagen-based composite hydrogel drive chondrogenesis . Adv Sci (Weinh) . 2019 ; 6 ( 16 ): 1900099 . Crossref PubMed Google Scholar
46. Brault J , Vigne B , Meunier M , et al. NOX4 is the main NADPH oxidase involved in the early stages of hematopoietic differentiation from human induced pluripotent stem cells . Free Radic Biol Med . 2020 ; 146 : 107 – 118 . Crossref PubMed Google Scholar
47. Schröder K , Wandzioch K , Helmcke I , Brandes RP . Nox4 acts as a switch between differentiation and proliferation in preadipocytes . Arterioscler Thromb Vasc Biol . 2009 ; 29 ( 2 ): 239 – 245 . Crossref PubMed Google Scholar
48. Zhou L , Song H , Zhang Y , Ren Z , Li M , Fu Q . Polyphyllin VII attenuated RANKL-induced osteoclast differentiation via inhibiting of TRAF6/c-Src/PI3K pathway and ROS production . BMC Musculoskelet Disord . 2020 ; 21 ( 1 ): 112 . Crossref PubMed Google Scholar
49. Abarzúa S , Ampuero E , van Zundert B . Superoxide generation via the NR2B-NMDAR/RasGRF1/NOX2 pathway promotes dendritogenesis . J Cell Physiol . 2019 ; 234 ( 12 ): 22985 – 22995 . Crossref PubMed Google Scholar
50. Li Y , Lin X , Zhu M , et al. A mutation in SLC20A2 (c.C1849T) promotes proliferation while inhibiting hypertrophic differentiation in ATDC5 chondrocytes . Bone Joint Res . 2020 ; 9 ( 11 ): 751 – 760 . Crossref PubMed Google Scholar
51. Rosenthal AK , Hempel D , Kurup IV , Masuda I , Ryan LM . Purine receptors modulate chondrocyte extracellular inorganic pyrophosphate production . Osteoarthr Cartil . 2010 ; 18 ( 11 ): 1496 – 1501 . Crossref PubMed Google Scholar
52. Liu Q , He F , Zhou P , et al. HMGB2 promotes chondrocyte proliferation under negative pressure through the phosphorylation of AKT . Biochim Biophys Acta Mol Cell Res . 2021 ; 1868 ( 11 ): 119115 . Crossref PubMed Google Scholar
53. Huang L-W , Huang T-C , Hu Y-C , et al. S-Equol protects chondrocytes against sodium nitroprusside-caused matrix loss and apoptosis through activating PI3K/Akt pathway . Int J Mol Sci . 2021 ; 22 ( 13 ): 7054 . Crossref Google Scholar
54. Harrington EK , Coon DJ , Kern MF , Svoboda KKH . PTH stimulated growth and decreased Col-X deposition are phosphotidylinositol-3,4,5 triphosphate kinase and mitogen activating protein kinase dependent in avian sterna . Anat Rec (Hoboken) . 2010 ; 293 ( 2 ): 225 – 234 . Crossref PubMed Google Scholar
55. Hubchak SC , Sparks EE , Hayashida T , Schnaper HW . Rac1 promotes TGF-beta-stimulated mesangial cell type I collagen expression through a PI3K/Akt-dependent mechanism . Am J Physiol Renal Physiol . 2009 ; 297 ( 5 ): F1316 – 23 . Crossref PubMed Google Scholar
56. Yen C-C , Hsiao C-D , Chen W-M , et al. Cytotoxic effects of 15d-PGJ2 against osteosarcoma through ROS-mediated AKT and cell cycle inhibition . Oncotarget . 2014 ; 5 ( 3 ): 716 – 725 . Crossref PubMed Google Scholar
57. Yu SM , Kim SJ . Thymoquinone-induced reactive oxygen species causes apoptosis of chondrocytes via PI3K/Akt and p38kinase pathway . Exp Biol Med (Maywood) . 2013 ; 238 ( 7 ): 811 – 820 . Crossref PubMed Google Scholar
58. Kwon J , Lee S-R , Yang K-S , et al. Reversible oxidation and inactivation of the tumor suppressor PTEN in cells stimulated with peptide growth factors . Proc Natl Acad Sci U S A . 2004 ; 101 ( 47 ): 16419 – 16424 . Crossref PubMed Google Scholar
Author contributions
Z-M. Liu: Conceptualization, Data curation, Methodology, Writing – original draft.
P-C. Shen: Conceptualization, Data curation, Methodology, Writing – original draft.
C-C. Lu: Investigation.
S-H. Chou: Investigation.
Y-C. Tien: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Writing – review & editing.
Funding statement
The authors disclose receipt of the following financial or material support for the research, authorship, and/or publication of this article: financial support by a grant from the Ministry of Science and Technology (Taipei, Taiwan; MOST 108-2314-B-037 -060 - and 110-2314-B-037 -030 - ) and Kaohsiung Medical University Chung-Ho Memorial Hospital (grant number: 103-3M35, 110-0R53, and 107-7M27).
ICMJE COI statement
All authors declare no conflicts of interest.
Acknowledgements
We appreciate the support from members of the Orthopedic Department of Kaohsiung Medical University Chung-Ho Memorial Hospital and the College of Medicine of Kaohsiung Medical University, Kaohsiung, Taiwan.
Ethical review statement
This study was approved by the Institutional Animal Care and Use Committee (IACUC) of Kaohsiung Medical University (KMU-108122).
Open access funding
The authors report that they received open access funding for their manuscript from the Ministry of Science and Technology.
Supplementary material
Figure showing the DNA affinity precipitation assay and chromatin-immunoprecipitation assay, and an ARRIVE checklist showing that the ARRIVE guidelines were adhered to in this study.
© 2022 Author(s) et al. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (CC BY-NC-ND 4.0) licence, which permits the copying and redistribution of the work only, and provided the original author and source are credited. See https://creativecommons.org/licenses/by-nc-nd/4.0/